SiRNA is a double-stranded RNA molecule with a length of about 20-25 base pairs, which is involved in the RNA interference process that consists in silencing of specific genes expression. The oligomers of siRNA have particular importance in gene therapy [1]. Gene therapy is extremely promising therapeutic method for the treatment of tumor, genetic disorders, neurodegenerative, autoimmune and infectious diseases. Very important in gene therapy is a delivery system (also known as vector), which improves the delivery of the new DNA or si-RNA into cells and protects the genetic material against degradation. A promising alternative to currently used vectors based on viruses seems to be gemini surfactants [2]. Such molecules have been recently an object of intense studies because they are characterized by low level of cytotoxicity and high transfection efficiency [3].

A series of SAXS studies were performed on a group of gemini surfactants which are quaternary salts (butane-, hexane- and pentane(bis-alkyloxyimidazolium) chlorides) mixed with single-stranded siRNA oligomers with a length of 21 base pairs (UGCAGGAUUCGAUGGAACCUU), to obtain four different values of N/P – the ratio of negative (siRNA) to positive charge (surfactant).

A series of the SAXS data sets were collected in DESY, at EMBL Beam Line X33 (Hamburg, Germany) [4], using synchrotron radiation (λ=0.15 nm) and Pilatus photon counting detector. Measurements were done at 20 °C for the range of the scattering vector 0.05 <s <5.0 nm^-1. All data sets were normalized to the intensity of the incident beam, corrected for detector response and scattering of the buffer was subtracted using PRIMUS [5].

On the basis of SAXS data the shape and symmetry of mixed siRNA/gemini surfactant systems were evaluated. The group of tested surfactant forms stable complexes with siRNA molecules. SAXS data indicate that the obtained lipolexes form probably unilamellar micelles.

The research was supported by research grant from the Ministry of Science and Higher Education (Poland) (Grant No. N N204 135738).

References

[1] A. Schroeder, C. G. Levins, C. Cortez, R.Langer, D. G.Anderson, J Intern Med,; 2672010: 9–21

[2]S.D. Wettig, R. Deubry, J. Akbar, T. Kaur, H. Wang, T. Sheinin, J.W. Joseph, R.A. Slavcev, Phys Chem Chem Phys 12, (2010) 4821-6

[2]. P.Luciani, C.Bombelli, M. Colone, L. Giansanti, S.J. Ryhanen, M.J. Saily, G. Mancini, P.K.J. Kinnunen, Biomacromolecules, 8, (2007) 1999-2003

[3] L.Karlsson, M.C.P. van Eijk, O.Soderman, J. Coll. Int. Sci. 252, (2002) 290-296

[4] M.W. Roessle, R. Klaering, U. Ristau, B. Robrahn, D. Jahn, T. Gehrmann, P. Konarev, A. Round, S. Fiedler, C. Hermes, D.I. Svergun, J. Appl. Crystallogr. 40, (2007) 190-194.

[5] P.V. Konarev, V.V. Volkov, A.V. Sokolova, M.H.J. Koch, D.I. Svergun, J. Appl. Crystallogr. 36 (2003) 1277-1282.

• Legal notice:
  

  Copyright (c) Pielaszek Research, all rights reserved.
  The above materials, including auxiliary resources, are subject to Publisher's copyright and the Author(s) intellectual rights. Without limiting Author(s) rights under respective Copyright Transfer Agreement, no part of the above documents may be reproduced without the express written permission of Pielaszek Research, the Publisher. Express permission from the Author(s) is required to use the above materials for academic purposes, such as lectures or scientific presentations.
  In every case, proper references including Author(s) name(s) and URL of this webpage: https://science24.com/paper/24603 must be provided.

1. Structural changes of DPPC bilayers induced by gemini surfactants
2. Studies of the structure and morphology of gold nanoparticles in solution by TEM, SAXS and UV-vis
3. Small angle X-ray scattering studies of Sgt1 protein from Hordeum vulgare
4. Structural changes of DMPC bilayers induced by gemini surfactants
5. Interactions between zwitterionic sufractants and DMPC